Reaksi berantai polimerase transkripsi-balik

Dari Wikipedia bahasa Indonesia, ensiklopedia bebas
Loncat ke navigasi Loncat ke pencarian

Reaksi berantai polimerase transkripsi-balik adalah teknik amplifikasi DNA komplemen dengan RNA virus melalui reaksi berantai polimerase yang menggunakan enzim transkriptase balik. Proses amplifikasi menggunakan sepasang primer oligonukleotida pada sekuen gen spesifik.[1] Reaksi berantai polimerase transkripsi-balik umumnya digunakan pada berbagai macam agen penyakit. Salah satu deteksinya yang umum ialah pada virus flu burung.[2] Selain itu, reaksi berantai polimerase transkripsi-balik dijadikan sebagai penanda molekuler untuk analisis asam nukleat pada uji koronavirus. Hasil pengujian dari reaksi berantai polimerase balik bersifat cepat dan dapat diandalkan. Keuntungan lain dalam penggunaannya adalah proses penargetan dan identifikasi patogen yang spesifik. Reaksi berantai polimerase transkripsi-balik mulai dikembangkan setelah diketahui mampu melakukan identifikasi genomik dan proteomik dari SARS-CoV-2.[3] Metode reaksi berantai polimerase transkripsi-balik menghasilkan analisis secara kualitatif.[4]

Prinsip kerja[sunting | sunting sumber]

Reaksi berantai polimerase transkripsi-balik merupakan pengembangan dari reaksi berantai polimerase. Dalam biologi molekuler, teknik ini digunakan untuk menghasilkan penggandaan untai DNA. Penggandaan diawali dengan transkripsi balik untai RNA menjadi DNA komplemen menggunakan enzim transkriptase balik. Proses penggandaan sama dengan reaksi berantai polimerase pada umumnya. Sepasang primer yang komplemen dengan sekuensing dua untai DNA komplemen digunakan sebagai bahan pengganda. Enzim DNA polimerase kemudian digunakan untuk memperpanjang ukuran primer sehingga akan dihasilkan untai ganda DNA.[5] Reaksi berantai polimerase transkripsi-balik juga digunakan untuk menggandakan jumlah RNA. Proses amplifikasi RNA tidak berbeda jauh dengan amplifikasi pada DNA. RNA target dihancurkan lalu diubah menjadi DNA melalui proses denaturasi yang menggunakan enzim transkriptase balik. Enzim ini mampu melakukan transkripsi RNA menjadi DNA.[6]

Tahapan[sunting | sunting sumber]

Deteksi ekspresi gen pada reaksi berantai polimerase transkripsi-balik terdiri dari tiga tahap. Tahap pertama isolasi RNA total, kemudian dilanjutkan dengan sintesis DNA komplemen, dan diakhiri dengan amplifikasi daerah transkip gen target. Tahpan-tahapannya secara rinci sebagai berikut:

  1. Tahap pertama adalah isolasi RNA. Sampel klinis pada tahap ini berasal dari jaringan tubuh, seperti darah, spesimen biopsi jaringan, dan kultur sel atau kultur jaringan. Tujuan isolasi RNA adalah untuk mendapatkan mRNA yang terkandung dalam sel. Isolasi RNA dimulai dengan melisiskan sel dan inti sel, lalu dilanjutkan dengan pemisahan DNA/RNA dan protein dengan metoda presipitasi protein, pemisahan RNA dan DNA dengan enzim DNase dan terakhir melakukan penyimpanan RNA dalam ddH2O bebas enzim nukleasi. Larutan RNA yang diperoleh langsung dianalisis dan dapat pula disimpan dalam jangka waktu lama pada suhu -80°C.
  2. Tahap kedua adalah sintesis DNA komplemen, yaitu mengubah RNA khususnya mRNA gen target menjadi DNA komplemen. Enzim yang digunakan ialah enzim transkriptase balik dan Oligo (dT) 15 primer . Larutan DNA komplemen yang akan digunakan secepatnya harus disimpan pada suhu 2-8°C bila selama 1-2 jam. Sedangkan suhu -15 °C hingga -25°C diterapkan pada penyimpanan dalam jangka waktu lama.
  3. Tahap ketiga adalah amplifikasi daerah transkrip gen target. Proses amplifikasi menggunakan primer oligonukleotida yang spesifik. Amplikon DNA komplemen akan dihasilkan jika reaksi berantai polimerase dilakukan dengan metode dua langkah. Kegunaan amplikon ini sebagai ekspresi transkrip gen target yang dapat divisualisasi secara biokimia dengan elektroforesis pada gel agarose. Penerapan klinis dari reaksi berantai polimerase transkripsi-balik ialah visualisasi ekspresi mRNA BRLF1 EBV pada penderita kanker nasofaring.[7]

Perlakuan[sunting | sunting sumber]

Dalam prosedur reaksi berantai polimerase transkripsi-balik, perlu diperhatikan hal-hal berikut:[8]

  1. Alat-alat yang bebas dari RNAseRNA sangat rentan terhadap RNAse yang menyebar di lingkungan, sehingga sangat dianjurkan menggunakan alat-alat yang bebas dari RNAse, seperti tabung Eppendorf dan tip mikropipet.
  2. Aluminium dianjurkan sebagai pelapisan pada peralatan laboratorium berbahan gelas. Degradasi RNAse melalui sterilisasi pada suhu >180°C selama 2 jam.
  3. Reagen dan larutan yang digunakan sebaiknya bebas RNAse. Dapat pula diberi perlakuan dengan dietil pirokarbonat (DEPC) 0,1 % v/v yang telah disterilisasi.
  4. Tris Hidroklorida tidak boleh diperlakukan dengan Dietil pirokarbonat, karena bersifat sangat reaktif.
  5. Menggunakan sarung tangan berbahan karet pada saat melakukan isolasi RNA. Tutup tabung eppendorf hanya dilakukan dalam waktu yang singkat.
  6. Meja laboratorium dibersihkan sebelum bekerja, Bahan pembersihnya berupa larutan natrium hipoklorit, etanol dengan kandungan 70 %, atau 0,1 % Sodium Dodesil Sulfat;
  7. Penyimpanan RNA dalam waktu yang lama dianjurkan pada suhu -80 °C.
  8. Isolasi RNA diperlakukan di atas es (suhu 4 °C) selama bekerja.
  9. Penyimpanan stok isopropanol dalam waktu yang lama dilakukan pada suhu -80 °C.
  10. Reagen transkriptase balik disimpan pada suhu -20 °C. Pengerjaan di atas es suhu 4 °C diterapkan pada saat melakukan sintesis DNA komplemen
  11. Penyimpanan DNA dan reagen dalam waktu yang lama dianjurkan pada suhu -80 °C.
  12. Preparasi untuk membuat campuran reaksi dilakukan di atas es dengan suhu 4 °C.
  13. Penyimpanan amplikon selama 1-2 hari menerapkan suhu 4 °C. Anjuran yang umum untuk produk reaksi adalah pada suhu -20 °C untuk penyimpanan waktu lama. Tujuannya adalah menghindari degradasi oleh aktivitas 5’-eksonuklease dari enzim Taq polimerase.

Jenis[sunting | sunting sumber]

Reaksi berantai polimerase transkripsi-balik multiprima (RT-PCR multiprima)[sunting | sunting sumber]

RT-PCR multiprima mendeteksi ekspresi mRNA gen laten pada biopsi jaringan tumor, kultur sel dan darah secara sensitif . Secara simultan, teknik ini mendeteksi ekspresi mRNA EBV yaitu EBNA1, EBNA2, LMP1, LMP2A, LMP2B, BZLF1, BARTs, dan U1A snRNP. Dalam deteksi, gen-gen tersebut dianggap sebagai gen rumah tangga untuk kontrol internal kuantitas RNA. Selanjutnya, dilakukan hibridisasi amplikon fragmen DNA komplemen dengan pelacak oligoneukleotida spesifik. Sebelum hibridisasi, masing-masing pelacak dilabeli dengan radioaktif agar meningkatkan spesifitas.[9] Autoradiografi pada film sinar-X menjadi visualisasi amplikon fragmen DNA komplemen yang menunjukkan ekspresi transkrip gen laten. RT-PCR multiprima sensitif dalam mendeteksi mRNA yang mengalami proses pembuangan intron dalam jumlah kecil. Selain itu, teknik ini sesuai pada deteksi yang memerlukan lebih sedikit jumlah sampel klinis. Kualitas kontrolnya juga dapat diandalkan pada biopsi jaringan limfoma dengan jumlah sedikit. Kuantitas RNA perlu diukur terlebih dahulu sebelum sampel dianalisis dengan teknik gel elektroforesis RNA untuk mendeteksi 18S RNA atau 28S RNA. Profil ekspresi transkrip gen laten EBV khususnya pada ekspresi gen laten I, II, dan III pada biopsi jaringan, kultur sel, dan darah sesuai diperiksa dengan teknik ini.[10]

Organisasi genom[sunting | sunting sumber]

Genom ORSV[sunting | sunting sumber]

Reaksi berantai polimerase transkripsi-balik telah digunakan untuk mengetahui organisasi genom Odontoglossum ringspot virus. Genom ini diketahui dengan penggunaan empat pasang primer yaitu POR-RdRpF, POR-RdRpR, POR-CPF dan POR-CPR. Bahan tambahan yang digunakan ialah dua suar molekuler dengan tipe MOR-RdRp dan MORCP.[11]

Deteksi virus[sunting | sunting sumber]

Virus flu burung[sunting | sunting sumber]

Reaksi berantai polimerase transkripsi-balik digunakan sebagai penanda molekuler lanjutan pada sampel virus yang berasal dari unggas. Pengujian ini diterapkan jika virus memiliki kemampuan melakukan aglutinasi SDM. Virus ini umumnya dalam famili Orthomyxoviridae yang menyebabkan influenza atau dalam famili Paramyxoviridae yang menyebabkan penyakit newcastle. Virus-virus tersebut diketahui ada jika hasil uji hemaglutinasi positif.[12] Isolasi RNA virus diterapkan untuk identifikasi subtipe virus flu burung. Primer yang digunakan spesifik terhadap Hahnium dan Natrium serta metode elektroforesis.[13]

Pada virus flu burung, hasil reaksi berantai polimerase transkripsi-balik dapat sangat bervariasi sesuai dengan jenis primer dan reagen kit yang digunakan.[14] Prosesnya juga memerlukan periode waktu tertentu. Proses transkripsi balik dilakukan selama 60 menit dengan suhu 45oC. Tahap predenaturasi dilakukan selama 5 menit pada suhu 95oC. Siklus reaksi berlanjut ke tahap denaturasi selama 30 detik pada suhu 95oC. Lalu aniling selama 30 detik dengan suhu 55oC 30 detik, dilanjutkan dengan tahap ekstensi selama 40 detik dengan suhu 72oC dan post ekstensi selama 10 menit dengan suhu 72oC.[15]

Setiap isolat diamplifikasi dengan primer H5 dan N1 untuk identifikasi subtipe virus. Primer spesifik hanya dilakukan pada isolat yang positif berdasarkan uji hemaglutinasi, tetapi hasil H5 dan N1 negatif. Primer ini umum digunakan pada virus penyakit newcastle. Suhu selama proses aniling mencapai 48oC. Keberadaan pita DNA spesifik hasil reaksi diidentifikasi melalui elektroforesis pada gel agarose dengan kadar 2%.[16]

Pasangan primer H5-1 dan H5-3 serta CU-N1F dan CU-N1R digunakan sebagai alat identifikasi subtipe H5 dan N1 secara berturut-turut. Sedangkan pasangan primer NDVF dan NDVR digunakan untuk identifikasi lebih lanjut terhadap virus penyakit newcastle. Ketiga pasang primer tersebut menghasilkan produk yang relatif kecil dengan 219 pasangan basa untuk H5, 131 pasangan basa untuk N1 dan 202pasangan basa untuk NDV. Hal ini membuat deteksi lebih sensitif dan spesifik. Setiap isolat diamplifikasi dengan primer H5 dan N1 untuk identifikasi subtipe virus. Primer spesifik untuk NDV menggunakan isolat negatif H5 dan N1, sedangkan isolat yang positif berdasarkan uji hemaglutinasi menggunakan primer non spesifik. Primer lain juga dapat digunakan sesuai dengan pustaka genom virus yang tersedia di GenBank.[17] Amplifikasi gen H5, N1 dan ND serta besaran produk PCR yang diharapkan, memerlukan sekuen basa berikut:[14]

Sekuen basa primer untuk mengamplifikasi gen H5, N1 dan ND serta besaran produk PCR yang diharapkan
Primer Sekuen basa Fragmen gen Produk (pasangan basa)
1 H5-1:

5‟GCC ATT CCA CAA CATACA CCC‟3

H5-3:

5‟CTC CCC TGC TCA TTGCTA TG‟3

H5

(basa 915-

1133)

219
2 CU-N1F:

5‟GTTTGAGTCTGTTGCTTGGTC‟ 3

CU-N1R:

5‟TGATAGTGTCTGTTATTATGCC‟3

N1

(basa

479-609)

131
3 NDVF:

5‟GGTGAGTCTATCCGGARGATACAAG‟3

NDVR:

5‟TCATTGGTTGCRGCAATGCTCT‟3

NDV

(basa 4829-

5030)

202

Virus imunodefisiensi manusia (HIV)[sunting | sunting sumber]

Proses hibridisasi pada reaksi berantai polimerase transkripsi-balik menggunakan pelacak DNA spesifik. Metode ini digunakan jika RNA HIV dapat dideteks dalam darah secara langsung baik secara kualitatif maupun kuantitatif.[18] RNA virus menjadi DNA komplemen diubah melalui ekstraksi dari plasma sampel dan dibiarkan bereaksi dengan enzim transkriptase balik. Reaksi yang timbul kemudian menguatkan potongan DNA spesifik yang berfungsi sebagai penyandi gen-gen virus tertentu. Manfaat lainnya adalah adanya refleksi ekspresi gen sehingga dapat mengamati ekspresi gen dari produksi RNA gen tertentu dan menghidupkan gen tertentu tersebut.[19]

Koronavirus 2019[sunting | sunting sumber]

Organisasi Kesehatan Dunia menjadikan reaksi berantai polimerase transkripsi balik sebagai tes pilihan dalam pengujian sampel pernapasan. Sensitivitas yang bervariasi bergantung pada asal spesimen tersebut diambil. Penyebaran virus/tingkat positif dapat bervariasi antara kedua kasus dan selama perjalanan penyakit. Maka suatu tes negatif tunggal tidak mengeksklusi kemungkinan infeksi.[20] Selain itu, Organisasi Kesehatan Dunia juga memberikan rekomendasi diagnosis infeksi SARS-CoV-2 menggunakan reaksi berantai polimerase transkripsi balik. Jumlah DNA komplemen SARS-CoV-2 dalam spesimen pasien dapat dihitung, karena deteksi menggunakan primer yang khusus menargetkan genom SARS-CoV-2.[21]

Reaksi berantai polimerase transkripsi-balik diterapkan pada pengujian sampel koronavirus.[22] Metode untuk pengujian asam nukleat ini secara umum terbagi menjadi 2 tahapan, yaitu proses transkripsi balik dari RNA menjadi DNA komplemen. Selanjutnya dilakukan tahap amplifikasi DNA komplemen.Secara umum, area dari genom SARS-CoV-2 yang menjadi target amplifikasi adalah gen protein E, gen protein N dan gen RdRP yang terdapat pada area rangka baca terbuka ORF1ab.[22] Konfirmasi hasilnya dapat diperoleh melalui sekuensing.[23] Spesifisitas tes dapat ditingkatkan pada target berjumlah lebih dari satu. Identifikasi virus dapat dilakukan dalam spesimen dengan jumlah virus yang sedikit. Selama tahap awal atau akhir koronavirus, kurangnya jumlah virus dapat terjadi pada orang tanpa gejala. Hal ini juga dapat terjadi karena proses pengumpulan spesimen yang tidak tepat. Kemampuan reaksi dalam mendeteksi koronavirus juga dipengaruhi oleh jenis sampel yang digunakan.[24]

Reaksi berantai polimerase transkripsi-balik mampu memeriksa banyak sampel sekaligus sehingga menyingkat waktu pengujian. Namun pemeriksaannya memerlukan teknisi profesional dengan kemampuan analisis data yang tepat. Selain itu, pengerjaan yang lebih rumit membutuhkan peralatan khusus. Kesalahan diagnostik dapat terjadi akibat kesalahan pengerjaan yang tidak sesuai dengan prosedur. Terjadinya kesalahan dapat dimulai sebelum proses analisa seperti identifikasi sampel dan pengambilan sampel yang tidak benar, kualitas spesimen yang buruk atau hanya mengandung sampel dengan jumlah yang sangat sedikit, kondisi pengiriman dan penyimpanan sampel yang tidak akurat, kontaminasi sampel, atau kesalahan pipeting selama persiapan sampel manual atau aliquot. Kesalahan juga dapat terjadi selama tahap analisa yang memungkinkan adanya hasil negatif palsu. Kesalahan ini dapat disebabkan oleh kontaminasi silang, pengujian di luar jendela diagnostik atau pada fase infeksi, ketidaksesuaian primer dan probe, penggabungan nukleotida yang salah, serta penempelan pada target non spesifik sebagai risiko rekombinasi aktif dan mutasi .[24]

Karakteristik deteksi RNA koronavirus dengan reaksi berantai polimerase transkripsi-balik adalah sebagai berikut:[25]

Deteksi RNA
Jenis deteksi Antigen berupa RNA virus
Jenis sampel Usap orofaring, usap nasofaring, sputum, cairan BAL
Batas kemapuan deteksi terendah 0,5 salinan/μL
Durasi pengujian sampel 2–3 jam
Daya guna alat pengujian Deteksi sampel dalam jumlah besar
Standar minimal keahlian petugas Memerlukan keahlian khusus dengan tingkat keterampilan tinggi
Kebutuhan peralatan dan ruangan Memerlukan alat dan ruangan laboratorium khusus. Standar minimalnya yaitu BSL-2
Biaya peralatan dan pemeriksaan Mahal
Risiko paparan virus ke petugas Risiko tinggi

Uji SARS-CoV-2 dilakukan dengan beberapa metode reaksi yang dikembangkan oleh beberapa negara maju. Metode pertama dibuat oleh Center for Disease Control and Prevention. Metode ini dikembangkan di Amerika Serikat. Gen dalam sekuen N protein dan RdRP ditargetkan menggunakan campuran primer N1 dan N2 serta pasangan primer RP. Primer 2019-nCoV digunakan untuk kontrol positif. Applied Biosystems 7500 Fast Dx Real-Time PCR digunakan untuk amplifikasi DNA komplemen. Sedangkan analisis data menggunakan perangkat lunak SDS versi 1.4. Metode kedua dikembangkan oleh Charité Germany di Jerman. Tahapan analisisnya terbagi menjadi tiga. Pertama, tahap skrining menggunakan primer gen E. Tujuannya untuk mendeteksi semua jenis SARS. Tahpa kedua yaitu konfirmasi menggunakan primer gen RdRp dengan dua probes yang berbeda dan dua macam primer. Sedangkan tahap terakhir disebut dengan tahap diskriminasi, karena mengunakan probe yang hanya bisa mendeteksi SARS-CoV-2. Metode ketiga dikembangkan di Institut Pasteur, Paris. Metode ini menargetkan gen RdRp dengan menggunakan primer dan probe. Primer E digunakan sebagai konfirmasi yang mengikuti protokol Charité.[22] Universitas Hong Kong dan BGI Group di Beijing mengembangkan metode Chinese National Institute for Viral Disease Control and Prevention. Metode Altona Diagnostics digunakan di Hamburg, Jerman. Singapura membuat metode uji SARS-CoV-2 di Agency for Science, Technology and Research dan MiRXES. Sedangkan di Berlin, uji SARS-CoV-2 dikembangkan oleh TIB Molbiol.[26]

Referensi[sunting | sunting sumber]

  1. ^ Susanti 2013, hlm. 48.
  2. ^ Dharmayanti, N.L.P.I, Hartawan, R., Hewajuli, D.A. (2016). "Pengembangan Sejumlah Primer untuk Reverse Transcriptase Polymerase Chain Reaction Guna Melacak Virus Flu Burung di Indonesia". Jurnal Veteriner. 17 (2): 184. doi:10.19087/jveteriner.2016.17.2.183. ISSN 2477-5665. 
  3. ^ Wardiana 2020, hlm. 23.
  4. ^ Rawpassa, I. E., Rafiah, S., dan S.A., I Wayan (2008). "Deteksi Helicobacter pylori pada Plak Gigi dengan Reverse Transcription-Polymerase Chain Reaction". Dentofasial. 7 (1): 41. 
  5. ^ Mahfut 2019, hlm. 32.
  6. ^ Susilowati 2019, hlm. 234-235.
  7. ^ Wahyono, dkk. 2017, hlm. 32.
  8. ^ Wahyono, dkk. 2019, hlm. 33-34.
  9. ^ Wahyono, dkk. 2017, hlm. 36.
  10. ^ Wahyono, dkk. 2017, hlm. 36-37.
  11. ^ Mahfut 2019, hlm. 38.
  12. ^ Susanti 2013, hlm. 40.
  13. ^ Susanti 2013, hlm. 46-47.
  14. ^ a b Susanti 2013, hlm. 53.
  15. ^ Susanti 2013, hlm. 53-54.
  16. ^ Susanti 2013, hlm. 54.
  17. ^ Susanti 2013, hlm. 52.
  18. ^ Rosilawati, M.L., dan Bela, Budiman (2007). "Teknik reverse transcription – polymerase chain reaction (RT-PCR) dan hibridisasi dot blot dengan pelacak DNA untuk deteksi human immunodeficiency virus (HIV) dalam serum darah". Universa Medicina. 26 (3): 113. 
  19. ^ Susilowati 2019, hlm. 235.
  20. ^ Setiawan, dkk. (978-623-232631-6). The Journey to Normal: Panduan Adaptasi Kebiasaan Baru Pada Masa Pandemi Covid-19 (PDF). Malang: UIN-MALIKI Press. hlm. 11. ISBN 978-623-232631-6. 
  21. ^ Agustina dan Fajrunni’mah 2020, hlm. 48.
  22. ^ a b c Wardiana 2020, hlm. 24.
  23. ^ Wardiana 2020, hlm. 25.
  24. ^ a b Agustina dan Fajrunni’mah 2020, hlm. 52.
  25. ^ Agustina dan Fajrunni’mah 2020, hlm. 51.
  26. ^ Wardiana 2020, hlm. 24-25.

Daftar pustaka[sunting | sunting sumber]

  1. Agustina, A.S., dan Fajrunni’mah, R. (2020). "Perbandingan Metode RT-PCR dan Tes Rapid Antibodi untuk Deteksi COVID-19". Jurnal Kesehatan Manarang. 6: 47–54. ISSN 2528-5602. 
  2. Mahfut (2019). Mengenal Anggrek Phalaenopsis dan Penyakit Virus Tanaman (PDF). Bandar Lampung: Aura. ISBN 978-623-211-139-4. 
  3. Susanti, R. (2013). Virus Avian Influenza dan Dinamika Molekulernya (PDF). Semarang: Fakultas Matematika dan Ilmu Pengetahuan Alam. ISBN 978-602-18553-5-5. 
  4. Susilowati, Rani Priastini (2019). Kajian Sel dan Molekuler: Hubungannya Dengan Penyakit Pada Manusia (PDF). Banyumas: Penerbit CV. Pena Persada. ISBN 978-979-3025-78-0. 
  5. Wahyono, dkk. (2017). Diagnosa Molekuler Epstein-Barr virus: Penatalaksanaan Karsinoma Nasofaring. Banyumas: Lembaga Penelitian dan Pengabdian Kepada Masyarakat (LPPM) Universitas Jenderal Soedirman. ISBN 978-602-1643-47-1. 
  6. Wardiana, Andri (2020). "Diagnosis SARS-CoV-2: Peran Sistem Deteksi dan Ragam Metode Uji Dalam Menanggulangi Pandemi COVID-19". BioTrends. 11 (1): 21–29.